Digest and PCR basics: cut a plasmid, copy a gene

• You will end with: fragments read from a digest of pLig-Vector, and a 323 bp PCR product from SDM-Template with EcoRI and BamHI sites, cut to a 313 bp piece on the shelf.
• Time: about 30 minutes.
• Files: pLig-Vector.gb and SDM-Template.gb (synthetic examples, plain downloads).
• Before this: Before you start, if the sample files or the enzyme ticks are new to you.

Exercise 1 of 2: the digest

1. File ▸ Open, select pLig-Vector.gb.
2. Close every other tab.
3. Open the Enzymes tab and click Hide all.

   A file you open opens with every single cutter ticked, and the digest follows the ticks and nothing else.

4. Type EcoRI in Filter and tick it.

   You see 2,664 bp under Fragments from ticked enzymes, and On a gel: 1 band, 2,664 bp.

5. Click the Cloning tab and pick Digest under Reaction.

   You see Digest with ticked enzymes with EcoRI beside it, 1 fragment, largest first., and one row: 2,664 bp, range 234–233, ends EcoRI 5′ AATT on both sides.

   Why

   One cut opens a circle: the same 2,664 bases are now a linear piece that starts just after the cut and runs round the old origin to end just before it, which is why its range wraps. A circle cut once gives one fragment, and that molecule is what you would clone into. The row also lists the features it carries: synthetic promoter, MCS, synthetic terminator, AmpR, +1 more.

6. Go back to the Enzymes tab, type XhoI in Filter and tick it as well, so EcoRI and XhoI are ticked.

   You see a lane for the double digest, a lane for each enzyme alone and a ladder, sizes 1,275, 969, 420 bp, and On a gel: 3 bands, 1,275 + 969 + 420 bp.

7. In the Cloning tab read the three rows:

   Fragment	Range	Left end	Right end
   1,275 bp	654–1,928	XhoI 5′ TCGA	XhoI 5′ TCGA
   969 bp	1,929–233	XhoI 5′ TCGA	EcoRI 5′ AATT
   420 bp	234–653	EcoRI 5′ AATT	XhoI 5′ TCGA

8. Hover the 969 bp row.

   You see the map and the sequence view draw that piece as a solid arrow while the others stay dashed.

9. Click its length to select it in the views. Then click a band in the gel in the Enzymes tab: the piece it stands for is selected too.
10. In the Enzymes tab, untick EcoRI, leaving only XhoI.

    You see 1,389, 1,275 bp, and the note, now in the warning colour: On a gel: 1,389 ×2 bp — one band, so there is nothing to tell apart; 1,389 and 1,275 run together.

    Why

    Two fragments are two pieces of DNA however they look on a gel. The gel is a rule of thumb: two bands within about 15 % of each other are called one, and these are less than 10 % apart. A different second enzyme, as in the double digest above, separates them.

11. Click Hide all, then tick EcoRI and EcoRV (use Filter for each).

    You see two fragments in the Cloning tab: 1,830 bp (EcoRV blunt to EcoRI 5′ AATT) and 834 bp (EcoRI 5′ AATT to EcoRV blunt).

    Fragment	Range	Left end	Right end
    1,830 bp	1,068–233	EcoRV blunt	EcoRI 5′ AATT
    834 bp	234–1,067	EcoRI 5′ AATT	EcoRV blunt

12. Click Add on the 834 bp row.

    You see Added ✓, then Add again, and the row says On shelf.

    • The last line of the tab reads The shelf holds 1 part, 834 bp.

    The shelf lives in the browser, so parts from an earlier session are still on it and add to the count. To start from none, open the Bench (the link at the bottom of the Cloning tab) and press Clear shelf.

13. Click Open on the 1,830 bp row.

    You see a new tab, pLig-Vector EcoRV-EcoRI fragment, with 1,830 bp, linear · EcoRV blunt / EcoRI 5′ AATT in the toolbar.

14. In the edit bar click Blunt (fill in).

    You see 1,834 bp and EcoRV blunt / EcoRI blunt in the toolbar: the four bases of the overhang AATT were copied into base pairs.

    Why

    A blunt end joins any other blunt end, so this is how an EcoRI end is made to meet an EcoRV one. Blunt (trim) is the other way: it removes the overhang instead, and here leaves the length at 1,830, because the top strand of this end already stops at the cut.

15. Press Ctrl+Z once to see the sticky end come back, and Ctrl+Shift+Z to blunt it again. (At the EcoRI end of the sequence view the other strand's four bases are drawn just outside the last column while it is sticky.)
16. Open the Enzymes tab, click Hide all, then open the Cloning tab.

    You see No enzyme is ticked, and the molecule still listed as one fragment, 1,834 bp, with the ends it has.

17. Click Add.
    • The last line of the tab reads The shelf holds 2 parts, 2,668 bp.

    If not, the total is the sum of what is on the shelf: 834 + 1,834 = 2,668. Check that the tab you added from is the blunted 1,834 bp piece and not the 1,830 bp one.

Exercise 2 of 2: the PCR

1. Open the Bench (the link at the bottom of the Cloning tab) and press Clear shelf, so the counts below start at none.
2. File ▸ Open SDM-Template.gb, close the other tabs, and make SDM-Template the tab in front.
3. In the Cloning tab pick PCR under Reaction.

   You see PCR with two primers, one template beside it, and the panel asks you to paste the two oligos.

4. Paste into Forward primer: ATGGCAAGGGGGCGTCTGTG
5. Paste into Reverse primer, written 5′ to 3′ as you would order it: TTATACTTCCACCAGAAGACGGTAACTG

   You see 20 nt, Tm 63 °C · → 139–158 under the forward box and 28 nt, Tm 59 °C · ← 414–441 under the reverse.

6. Read the product: the panel says One product: and lists 303 bp, 139–441, exact match, with Show, Shelve and Open. Under it a gel draws one band in a lane labelled PCR.
7. Set Polymerase to Taq.

   You see 304 bp, one base longer, and the note One 3′ A on each end, for TA cloning.

8. Set Polymerase back to Proofreading.
9. Click Show.

   You see the map and the sequence view draw the product as a span with the two primers as arrows on it, and the button reads Hide.

10. Click Hide to take them off.
11. Replace the primers with ones that carry a restriction site on a tail. Forward: GGGAATTCTTATGGCAAGGGGGCGTCTGTG, reverse: GCGGATCCTTTTATACTTCCACCAGAAGACGGTAACTG

    You see 30 nt, 10 of them a 5′ tail, Tm 63 °C on the template, 67 °C once the product carries it · → 139–158 and 38 nt, 10 of them a 5′ tail, Tm 59 °C on the template, 66 °C once the product carries it · ← 414–441. The product is 323 bp, 139–441, exact match, 20 bp of tail.

    Why

    The tail is GGG + GAATTC (EcoRI) + TT on the forward and GCG + GGATCC (BamHI) + TT on the reverse. The bases outside the site are a clamp, because an enzyme cuts poorly at the very end of a molecule. The positions stay 139–441 because a tail pairs with nothing, yet the product is 20 bp longer because it carries both tails. The two temperatures are why a tailed pair is cycled first at the lower Tm and then at the higher.

12. Click Shelve.
    • The last line of the tab reads The shelf holds 1 part, 323 bp.
13. Click Open.

    You see a new tab, SDM-Template PCR product, linear, 323 bp, with synthORF and a Forward and a Reverse primer feature on it.

14. In its Enzymes tab click Hide all, then tick EcoRI and BamHI.
15. In the Cloning tab (Digest) read the three fragments:

    Fragment	Left end	Right end
    313 bp	EcoRI 5′ AATT	BamHI 5′ GATC
    7 bp	BamHI 5′ GATC	plain blunt end
    3 bp	plain blunt end	EcoRI 5′ AATT

    Why

    The clamps are what is left over. The 313 bp piece is the gene with an EcoRI end and a BamHI end, the same two enzymes in the same order as the MCS of pLig-Vector, so it is ready for Ligation.

16. Click Add on the 313 bp row (range 4–316).
    • The shelf now holds 2 parts, 636 bp.

    If not, the total is 323 + 313 = 636: check that you added the 313 bp row and not another one.

17. Look at the sequence of the SDM-Template PCR product tab.

    You see its first ten and last ten bases in capitals and the gene between them in lower case.

18. Back in the SDM-Template tab, try the first wrong pair. Forward: ATGGCAAGGGGGCGTCTGTG, and reverse, pasted as it stands in the gene and not reverse-complemented: CAGTTACCGTCTTCTGGTGGAAGTATAA

    You see no product, and: Both primers anneal to the same strand of SDM-Template, so they both copy the same way and nothing is amplified. One of them wants reverse-complementing.

    Why

    A reverse primer is the reverse complement of the template's end. A primer pasted straight from the sequence copies the same strand as the forward one, so the two never meet. Pointing away is not wrong on a plasmid, though: forward CAGTTACCGTCTTCTGGTGGAAGTATAA with reverse CACAGACGCCCCCTTGCCAT (the two ends of synthORF, each pointing out of the gene) lists 986 bp, 414–158, over the origin on a circle. That is inverse PCR, how a vector is linearised; on a linear template the same pair would say the primers point away from each other.

19. Now a primer that matches nothing. Forward: ACGTACGTACGTACGTACGTAC, with the good reverse from step 5.

    You see 22 nt — no 3′ end long enough to prime. The last 5 bases have to match exactly. under the forward box and, in red, Forward does not anneal to SDM-Template, so there is nothing for the other primer to meet. No Shelve button appears.

Done when:

• The shelf holds 2 parts, 2,668 bp after Exercise 1 (834 and 1,834), and 2 parts, 636 bp after Exercise 2 (323 and then the 313 bp EcoRI–BamHI piece).
• The plain pair gave 303 bp (139–441), the tailed pair 323 bp with 20 bp of tail.

Next: Ligation joins pieces on the Bench. Back to the tutorials index. The guide's Digest, Sticky ends on a document, PCR and The shelf are the reference for what you did here.

How it works

Nothing on this page joins anything: joining is the Bench, and the tutorials after this one use it. What these two panels give the Bench is the shelf, the parts you collect here. There is no NCBI gene path in this tutorial: a gene fetched from NCBI is digested and amplified the same way, step for step, but these exercises need plasmids whose sites and primer positions are known.

The enzymes' positions are all you need for Exercise 1: EcoRI cuts pLig-Vector at 233 and XhoI at 653 and 1,928, EcoRV at 1,067 (blunt). The EcoRI and BamHI sites of SDM-Template are outside synthORF, so a PCR that copies only the gene has neither, and the tails in Exercise 2 add them.

Eight words:

• Digest: cutting DNA with restriction enzymes. The panel cuts the document with the enzymes ticked in the Enzymes tab, all at once and completely, and lists the pieces.
• Fragment: one piece of a digest. A circle cut once is one fragment, opened up; a circle cut n times gives n; a linear molecule cut n times gives n + 1.
• Sticky end: an end where one strand sticks out past the other. EcoRI leaves a 5′ overhang, AATT. Two sticky ends with the same overhang can pair; that is what ligation uses.
• Blunt end: both strands stop together, as EcoRV leaves them. A PCR product from a proofreading polymerase is blunt at both ends.
• Blunting: turning a sticky end into a blunt one. Fill in (Klenow or T4 DNA polymerase) copies a 5′ overhang into base pairs; trim (mung bean nuclease) removes an overhang.
• Shelf: the parts you collect for the Bench. It lives in the browser, so a part stays until you remove it.
• Primer: a short oligo written 5′ to 3′ as you would order it. Only its 3′ end has to match the template; the rest is a tail, and it is copied into the product all the same.
• Tm: the melting temperature of the part that anneals. A primer with a tail has two, one on the template and a higher one once the product carries the whole oligo.

Other methods to know: the product's capital letters mean "not from the template", the way a primer is written out in a paper; what is left in capitals is the 5′ tails and any mismatch. A primer must match exactly in its last five bases, though up to two mismatches further back are allowed and are carried into the product. A shelved product still has to be cut before it joins: its sites are not exposed until an enzyme has cut them, and the shelved product is marked dephosphorylated, because oligos are made without a 5′ phosphate unless you order them with one.

Methylation. Some enzymes will not cut a site that dam or dcm methylation covers. None of the sites in these two files is in such a context, so the numbers above do not depend on it; when one is, the Cloning tab says how many sites it left out and why. See Where the DNA was grown.