Site-directed mutagenesis: a point mutation, a tag, a deletion and a new site

• You will end with: a point mutation, a tag, a deletion and a silent EcoRV site, each as primers plus the plasmid they make (the silent one is a 1,241 bp circle that a BamHI + EcoRV digest cuts into 965 and 276 bp), then a change the primers cannot reach and what the panel says about it.
• Time: about 25 minutes.
• Files: SDM-Template.gb (synthetic, a plain download).
• Before this: nothing; Before you start helps if the sample files or the enzyme ticks are new to you.

Mutagenesis works on the one document in front of you, so it is in the Cloning tab of the sidebar, beside Digest and PCR, not on the Bench. Each exercise starts from the template, not from the last mutant: close the mutants you open and keep SDM-Template as the tab to work in.

Exercise 1 of 4: one amino acid, K14R

1. Choose File ▸ Open and select SDM-Template.gb. Close every other tab.

   You see SDM-Template, 1,241 bp, circular, as the only tab.

   Why

   The panel designs primers for the document in front of you, so the template must be the tab that is showing.

2. Open the Enzymes tab and click Hide all.
3. Type BamHI in Filter and tick it.
   Why

   You will see at the end that the mutant opens with the template's ticks, not with every enzyme that happens to cut it once.

4. Press Ctrl+F, type AAGAACAGC and press Enter.

   You see both views scroll to the match, at bases 178 to 186, and select it.

5. Press Esc to close the bar.
6. In the sequence view, in the line of amino acids under the bases, click the K at the left of the match. If there is no amino-acid line, switch on Translations in the Format menu.

   You see the status bar start 3 bp selected, 178 to 180.

   Why

   Clicking an amino acid selects that residue's three bases and nothing else, which is what a change to one residue needs.

7. Click the Cloning tab and pick Mutate under Reaction.

   You see Change 3 bp at 178 (AAG). and, under Change a residue, the heading note synthORF K14 (AAG).

8. Under To, choose R — Arginine (the Host stays E. coli).

   You see six codons: CGC 40 % ★, CGT 38 %, CGG 10 %, CGA 6 %, AGA 4 % and AGG 2 %.

9. Hover AGG, then click it. It changes 1 base; CGC changes 3.
   Why

   The star is the host's commonest arginine codon. AGG is the rarest in E. coli, but it keeps the change to a single base, the cleanest first example; for protein you mean to express you would choose CGC.

10. Read the panel. Change to now holds AGG, and the panel names the change in bold: AAG178–180AGG · synthORF K14R. The primers, written 5′ to 3′ as you would order them, are listed under Forward and Reverse:

    Primer	Sequence (upper case is new)	Length	Tm	NEB Q5
    Forward	AGGaacagcctacgcctggcc	21 nt	60 °C, 18 anneal	71 °C
    Reverse	cggatttctagatatgttccacagacgcc	29 nt	61 °C, 29 anneal	70 °C

    You see a note under them: amplify the whole plasmid, annealing at 71.3 °C (NEB's for Q5), then phosphorylate, ligate and digest the template (KLD).

    Why

    The forward primer begins with the new codon and anneals just after it; the reverse anneals to the bases just before it. They point away from each other and share no base, so the change is the join between them.

11. Click Overlapping.

    You see the primers catatctagaaatccgAGGaacagcctacgcctg and caggcgtaggctgttCCTcggatttctagatatg, 34 nt, Tm 79 °C (Agilent) each.

    The note says to copy the plasmid round, digest the template with DpnI and transform. Each primer is the reverse complement of the other, so they overlap along their whole 34 bases, with the new codon (and its complement, CCT) in the middle and 16 and 15 template bases either side.

12. Click Back to back to return.
13. Click Open mutant.

    You see a new tab, SDM-Template AAG178–180AGG, with the Features tab in front.

14. Open the Enzymes tab.

    You see only BamHI ticked, as on the template.

15. Press Ctrl+Z once, then Ctrl+Shift+Z.

    You see the template's base come back, then the change again.

    Why

    The mutant is the template with the change as its one edit, so undo works, and it keeps the ticks you had: that is what lets the check digest in Exercise 3 start from enzymes you chose.

• The mutant is 1,241 bp, circular, with a forward primer of 21 nt and a reverse of 29 nt.

If not: check that the K is selected (Change 3 bp at 178 (AAG).) and that AGG is in Change to.

Exercise 2 of 4: a short insertion and a deletion

Two changes, one after the other, each made on the template. Close the mutant from Exercise 1 first, and make SDM-Template the tab showing.

An insertion: a His tag before the stop codon

1. Press Ctrl+F, type CTGGTGGAAGTA and press Enter.

   You see the match run from base 427 to 438, the last residue (V, number 100) being its last three bases.

2. Press Esc, then the → key.

   You see the status bar read Cursor after base 438.

   Why

   The arrow collapses the selection to a cursor at its right end, which is where the tag goes: after the last residue, in front of the stop.

3. In the Cloning tab, with Mutate picked, read the panel.

   You see Insert after base 438. and the box now labelled Bases to insert.

4. Type CACCACCACCACCACCAC (six CAC codons) in Bases to insert.

   You see the change named +CACCACCACCACCACCAC after 438 · synthORF 101 (none) → HHHHHH.

   Why

   Every codon is CAC, histidine, and 18 is a multiple of three, so the insertion stays in frame. Residue 101 was the stop and held no amino acid, which is why the gain reads 101 (none) → HHHHHH.

5. Read the back-to-back primers:

   Primer	Sequence (upper case is new)	Length	Tm	NEB Q5
   Forward	CACCACCACCACCACCACtaaggatgcggtcccctggt	38 nt	60 °C, 20 anneal	71 °C
   Reverse	tacttccaccagaagacggtaactgc	26 nt	61 °C, 26 anneal	70 °C

   You see the note give annealing at 71.1 °C.

   Why

   The whole tag rides on the forward primer's 5′ tail (an insert over 20 bases would be split between the two). The 18 new bases are not part of the annealing Tm.

6. Click Open mutant.

   You see a tab SDM-Template +CACCACCACCACCACCAC after 438, 1,259 bp (1,241 + 18).

7. Open its Features tab.

   You see synthORF now run 139 to 459, and the terminator follow it at 460 to 539.

• The mutant is 1,259 bp, circular, and the translation ends …LLVEV then HHHHHH then the stop: 106 residues, where the template has 100.

If not: check that the cursor was after base 438 and that all 18 bases are in Bases to insert.

A deletion: one residue gone

1. Close the mutant, and make SDM-Template the tab showing.
2. Press Ctrl+F, type AGTTGTGAAATG, press Enter, then Esc.

   You see the match, bases 310 to 321, the codons for S, C, E and M.

3. Click the E on the amino-acid line.

   You see the three bases at 316 to 318 selected and the panel say Change 3 bp at 316 (GAA).

4. Do not type anything: Change to reads leave empty to delete.

   You see the deletion already designed: Δ316–318 · synthORF 60 E → (none).

   Why

   An empty box is the change. It is also why a selection you have not decided about already shows primers: they are for deleting it.

5. Read the primers: atgtttatgtctctctgtggtaagtggcc (29 nt, Tm 61 °C, NEB Q5 70 °C, all 29 anneal) and acaactcatgaaaagctgggtagctttt (28 nt, 60 °C, 68 °C, all 28 anneal), annealing at 69.5 °C.

   You see both in lower case: a deletion puts no new base into either primer.

6. Click Open mutant.

   You see a tab SDM-Template Δ316–318, 1,238 bp.

• The mutant is 1,238 bp, circular, and synthORF runs 139 to 438, 300 bases.

If not: check that only the E (316 to 318) was selected and Change to is empty.

Exercise 3 of 4: a silent change that makes a site

A change that costs the protein nothing and gives the DNA a restriction site, so that a miniprep digest tells the mutant from the template.

1. Close the mutants. With SDM-Template showing, press Ctrl+F, type GATATTCAG, press Enter, then Esc.

   You see bases 256 to 264 selected, the codons for D, I and Q.

2. In the Enzymes tab type EcoRV in Filter and tick it.

   You see no EcoRV cut: the template has no EcoRV site.

   Why

   EcoRV cuts GAT^ATC, and the template reads GATATT, one base from it.

3. Click the I on the amino-acid line, the second of the three.
4. In the Cloning tab, under Mutate, read the panel.

   You see Change 3 bp at 259 (ATT) and the heading note synthORF I41 (ATT).

5. Under To, choose I — Isoleucine (as now).
6. Click ATC, the codon that changes one base.
   Why

   ATT and ATC both code for isoleucine, and the T to C turns GATATT into GATATC.

7. Read the panel.

   You see the change named ATT259–261ATC · synthORF no change (silent).

8. Read the primers: forward ATCcagtggctttcttacgtttatttacgaaaagc (35 nt, Tm 60 °C, NEB Q5 68 °C, 32 anneal) and reverse atcacaggggaccatccggt (20 nt, Tm 60 °C, NEB Q5 71 °C, 20 anneal), annealing at 68.6 °C.
   Why

   The forward primer is longer than in Exercise 1 and its annealing part is 32 bases, not 18: the panel keeps adding bases until the annealing part reaches 60 °C, and the bases here are less GC-rich.

9. Click Open mutant.

   You see SDM-Template ATT259–261ATC, 1,241 bp, with BamHI and EcoRV ticked in the Enzymes tab.

10. Look at the map and the sequence view.

    You see EcoRV once, at 256 to 261, and BamHI once, at 534 to 539.

11. Click the Cloning tab and pick Digest.

    You see 2 fragments, largest first: 965 bp and 276 bp.

    If the digest lists more enzymes than these two, others are ticked: only BamHI and EcoRV should be. A template you open fresh has every enzyme that cuts it once ticked; Exercise 1 cleared them and ticked BamHI.

12. Switch to the template's tab.

    You see the same digest say 1 fragment, 1,241 bp, because only BamHI cuts it.

    Why

    This is the check. A circle cut twice gives two bands (EcoRV cuts between 258 and 259, BamHI between 534 and 535, and 276 is the stretch between them); one cut gives one band the size of the whole plasmid.

13. In the mutant, untick BamHI.

    You see one fragment of 1,241 bp, from the EcoRV cut alone.

• The mutant is 1,241 bp, circular, with GATATC at 256 to 261, and BamHI + EcoRV give 965 and 276 bp.

If not: check that ATC (not ATT) is in Change to and that both enzymes are ticked.

Exercise 4 of 4: a change the primers cannot reach

The panel always gives a design, and says so when it falls short.

1. Close the mutants. With SDM-Template showing, press Ctrl+F, type AAATATAAAATA, press Enter, then Esc.

   You see the match, inside the AT-rich spacer (90 bases with no G or C).

2. Press →.

   You see the status bar read Cursor after base 590.

3. Hold Shift and press → once.

   You see one base selected, the A at 591, and the panel say Change 1 bp at 591 (A).

4. Type G in Change to.

   You see the change named A591G, and, as it is not in a coding region, no protein change after it.

5. Read both primers: a forward of 61 nt and a reverse of 60 nt, Tm 55 and 57 °C (NEB Q5 60 and 63 °C), every annealing base from the template.

   You see a warning line: The template next to the change is too AT-rich to reach 60 °C within 60 bases.

   Why

   The longest primer the panel will write is 60 bases of annealing part, and in a stretch of only A and T that is not enough to reach 60 °C. The design is shown rather than refused, so you can see how far short it is.

6. Click Overlapping.

   You see a warning line again: The primers reach only 69 °C at 60 bases, short of the 78 °C QuikChange asks for.

7. Select the codon at 178 to 180 as in Exercise 1 and type AGG, then look at Back to back and Overlapping.

   You see the same two designs with no red line.

   Why

   The failure is where the change is, not the method.

• Both designs at base 591 carry a warning, and neither does at the codon 178 to 180.

If not: check that Change to holds G and that the A at 591 is the one base selected.

The way out is to move the change if you can, or to accept a lower annealing temperature and say so in the lab; the panel does not decide that for you. And when the box has a character that is not a base, a note under it says what was left out (Left out, not bases: “#”.), so a change that came out shorter than you typed says why.

Done when:

• Each mutant opens as SDM-Template with its one edit (1,241, 1,259, 1,238 and 1,241 bp, circular).
• The silent mutant's digest with BamHI + EcoRV gives 965 and 276 bp, where the template gives one 1,241 bp band.

Next: back to the tutorials index.

How it works

This is a synthetic example (invented sequence). PlasmidPop designs the primers and shows the plasmid they make; it does not simulate the PCR, the KLD or the DpnI step. There is no NCBI gene path in this tutorial: a gene you fetch from NCBI is mutated the same way, step for step.

SDM-Template is 1,241 bp, circular: synthetic promoter (1–120), synthORF (139–441, 100 codons and a stop), synthetic terminator, AT-rich spacer (552–641), AmpR and ori stand-ins. synthORF starts MARGRLWNISRNPK (residue 14 is a lysine, AAG at 178–180) and ends …LLVEV, then the stop. Residue 41 is an isoleucine, GATATT (bases 256–261) is a hair from an EcoRV site, and a BamHI site sits at 534–539, after the terminator. The spacer is 90 bases of only A and T, which is what the last exercise is about. There is no EcoRV site anywhere in the template.

Seven words:

• Mutagenic primer: a primer whose bases differ from the template at the change. Mutagenesis needs two, one for each strand, and the whole plasmid is copied with them.
• Back to back: NEB's Q5 site-directed mutagenesis design (the panel's default). The two primers point away from each other and meet at the change, which rides on the 5′ end of the forward one. They do not overlap. After the PCR the linear product is phosphorylated, ligated and the template digested (KLD).
• Overlapping: Agilent's QuikChange design. The two primers are each other's reverse complement, with the change in the middle, so they overlap along their whole length. The plasmid is copied round and the template is digested with DpnI.
• Annealing part: the 3′ end of a primer that pairs with the template. In the panel the new bases are in upper case and the annealing part in lower.
• Tm: the melting temperature of the annealing part (nearest neighbour, as elsewhere in the app). For back to back the panel grows each annealing part until it reaches 60 °C and also shows NEB Q5, the Tm NEB's own calculator gives for that enzyme, a few degrees higher.
• Silent change: a different codon for the same amino acid. The protein is untouched, but the DNA is not.
• Check digest: cutting the clone with enzymes to see bands that tell the mutant from the template. A silent change that makes or breaks a site gives you one without sequencing.

Site-directed mutagenesis in the user guide also covers a library at a codon (NNK, NNS, NNN, NDT), a change at the end of a linear sequence, and a change across the origin of a circle. The design note is item 47 (docs/design/47-mutagenesis.md).